BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 19435

Title: Structural studies on dinuclear ruthenium(II) complexes that bind diastereoselectively to an anti-parallel folded human telomere sequence   PubMed: 24088028

Deposition date: 2013-08-18 Original release date: 2013-09-30

Authors: Williamson, Mike; Wilson, Tom; Thomas, James; Felix, Vitor; Costa, Paolo

Citation: Wilson, Tom; Costa, Paulo; Felix, Vitor; Williamson, Mike; Thomas, Jim. "Structural Studies on Dinuclear Ruthenium(II) Complexes That Bind Diastereoselectively to an Antiparallel Folded Human Telomere Sequence."  J. Med. Chem. 56, 8674-8683 (2013).

Assembly members:
human_telomere_quadruplex, polymer, 22 residues, 135.128 Da.
entity_RUL, non-polymer, 1211.268 Da.

Natural source:   Common Name: Human   Taxonomy ID: 9606   Superkingdom: Eukaryota   Kingdom: Metazoa   Genus/species: Homo sapiens

Experimental source:   Production method: chemical synthesis

Entity Sequences (FASTA):
human_telomere_quadruplex: AGGGTTAGGGTTAGGGTTAG GG

Data sets:
Data typeCount
1H chemical shifts196

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all