BMRB Entry 19448
Click here to enlarge.
PDB ID: 2mco
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR19448
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: Structural studies on dinuclear ruthenium(II) complexes that bind diastereoselectively to an anti-parallel folded human telomere sequence PubMed: 24088028
Deposition date: 2013-08-22 Original release date: 2013-10-14
Authors: Williamson, Mike; Wilson, Tom; Thomas, James; Felix, Vitor; Costa, Paolo
Citation: Wilson, Tom; Costa, Paulo; Felix, Vitor; Williamson, Mike; Thomas, Jim. "Structural Studies on Dinuclear Ruthenium(II) Complexes That Bind Diastereoselectively to an Antiparallel Folded Human Telomere Sequence." J. Med. Chem. 56, 8674-8683 (2013).
Assembly members:
human_telomere_quadruplex, polymer, 22 residues, Formula weight is not available
entity_2FJ, non-polymer, 1211.268 Da.
entity_NA, non-polymer, 22.990 Da.
Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
human_telomere_quadruplex: AGGGTTAGGGTTAGGGTTAG
GG
- assigned_chemical_shifts
| Data type | Count |
| 1H chemical shifts | 196 |