BMRB Entry 19540
Click here to enlarge.
PDB ID: 2mf8
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full, LACS
BMRB Entry DOI: doi:10.13018/BMR19540
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: haddock model of MyT1 F4F5 - DNA complex PubMed: 24097990
Deposition date: 2013-10-08 Original release date: 2013-11-04
Authors: Gamsjaeger, Roland; O'Connell, Mitchell; Cubeddu, Liza; Shepherd, Nicholas; Lowry, Jason; Kwan, Ann; Vandevenne, Marylene; Swanton, Michael; Matthews, Jacqueline; Mackay, Joel
Citation: Gamsjaeger, Roland; Cubeddu, Mitchell; Shepherd, Liza; Lowry, Nicholas; Kwan, Jason; Vandevenne, Ann; Swanton, Marylene; Matthews, Michael; Mackay, Jacqueline. "A structural analysis of DNA binding by myelin transcription factor 1 double zinc fingers." J. Biol. Chem. 288, 35180-35191 (2013).
Assembly members:
entity_1, polymer, 93 residues, 65.380 Da.
DNA_26_mer, polymer, 26 residues, Formula weight is not available
entity_ZN, non-polymer, 65.409 Da.
Natural source: Common Name: E. coli Taxonomy ID: 562 Superkingdom: Bacteria Kingdom: not available Genus/species: Escherichia coli
Experimental source: Production method: recombinant technology Host organism: Escherichia coli
Entity Sequences (FASTA):
entity_1: GPLGSFDIKKELLTCPTPGC
DGSGHITGNYASHRSLSGCP
LADKSLRNLMAAHSADLKCP
TPGCDGSGHITGNYASHRSL
SGCPRAKKSGLRV
DNA_26_mer: ACCGAAAGTTCACGTGAACT
TTCGGT
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 115 |
| 15N chemical shifts | 51 |
| 1H chemical shifts | 51 |
Additional metadata:
Download simulated HSQC data in one of the following formats:
CSV: Backbone
or all simulated shifts
SPARKY: Backbone
or all simulated shifts