BMRB Entry 19634

Name: Solution structure of the CR4/5 domain of medaka telomerase RNA
Published: 2013-12-23

Click here to enlarge.

PDB ID: 2mhi
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR19634
MolProbity Validation Chart

NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry

Nicholas Rego and David Koes
3Dmol.js: molecular visualization with WebGL
Bioinformatics (2015) 31 (8): 1322-1324 doi:10.1093/bioinformatics/btu829

Select model:

I am color blind

Download raw data. Direct link to this display. Help

Title: Solution structure of the CR4/5 domain of medaka telomerase RNA PubMed: 24335084

Deposition date: 2013-11-23 Original release date: 2013-12-23

Authors: Kim, Nak-Kyoon; Zhang, Qi; Feigon, Juli

Citation: Kim, Nak-Kyoon; Zhang, Qi; Feigon, Juli. "Structure and sequence elements of the CR4/5 domain of medaka telomerase RNA important for telomerase function." Nucleic Acids Res. 42, 3395-3408 (2014).

Assembly members:
CR4/5 domain of medaka telomerase RNA, polymer, 53 residues, 135.128 Da.

Natural source: Common Name: Japanese medaka Taxonomy ID: 8090 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Oryzias latipes

Experimental source: Production method: enzymatic semisynthesis Host organism: Oryzias latipes

Entity Sequences (FASTA):
CR4/5 domain of medaka telomerase RNA: GGAAACGCCGCGGUCAGCUC GGCUGCUGCGAAGAGUUCGU CUCUGUUGUUUCC

Data sets:

assigned_chemical_shifts
- assigned_chem_shift_list_1

Data type	Count
13C chemical shifts	335
15N chemical shifts	65
1H chemical shifts	463

Additional metadata:

Assembly
Samples and Experiments
Software
Spectrometers
Hide all

Entity Assembly ID	Entity Name	Entity ID
1	CR4/5 domain of medaka telomerase RNA	1

Samples:

mdCR4-5-H2O: mdCR4/5 1.2 mM; sodium phosphate 10 mM; potassium chloride 100 mM

mdCR4-5-D2O: mdCR4/5 1.2 mM; sodium phosphate 10 mM; potassium chloride 100 mM

FL-mdCR4-5-H2O: mdCR4/5, [U-13C; U-15N], 1 mM; sodium phosphate 10 mM; potassium chloride 100 mM

A-mdCR4-5-D2O: mdCR4/5, [U-13C; U-15N]-Ade, 1 mM; sodium phosphate 10 mM; potassium chloride 100 mM

U-mdCR4-5-D2O: mdCR4/5, [U-13C; U-15N]-Ura, 1 mM; sodium phosphate 10 mM; potassium chloride 100 mM

G-mdCR4-5-D2O: mdCR4/5, [U-13C; U-15N]-Gua, 1 mM; sodium phosphate 10 mM; potassium chloride 100 mM

C-mdCR4-5-D2O: mdCR4/5, [U-13C; U-15N]-Cyt, 1 mM; sodium phosphate 10 mM; potassium chloride 100 mM

D-mdCR4-5-D2O: mdCR4/5, [U-2H], 1.5 mM; sodium phosphate 10 mM; potassium chloride 100 mM

D-mdCR4-5-H2O: mdCR4/5, [U-2H], 1.5 mM; sodium phosphate 10 mM; potassium chloride 100 mM

mdCR4-5-293: ionic strength: 10 mM; pH: 6.3; pressure: 1 atm; temperature: 293 K

mdCR4-5-283: ionic strength: 10 mM; pH: 6.3; pressure: 1 atm; temperature: 283 K

Experiments:

Name	Sample	Sample state	Sample conditions
2D 1H-15N HSQC	FL-mdCR4-5-H2O	isotropic	mdCR4-5-283
2D 1H-13C HSQC	FL-mdCR4-5-H2O	isotropic	mdCR4-5-293
2D 1H-13C HSQC	A-mdCR4-5-D2O	isotropic	mdCR4-5-293
2D 1H-13C HSQC	U-mdCR4-5-D2O	isotropic	mdCR4-5-293
2D 1H-13C HSQC	G-mdCR4-5-D2O	isotropic	mdCR4-5-293
2D 1H-13C HSQC	C-mdCR4-5-D2O	isotropic	mdCR4-5-293
2D DQF-COSY	mdCR4-5-D2O	isotropic	mdCR4-5-293
2D 1H-1H COSY	mdCR4-5-D2O	isotropic	mdCR4-5-293
2D 1H-1H NOESY	mdCR4-5-H2O	isotropic	mdCR4-5-283
2D 1H-1H NOESY	mdCR4-5-D2O	isotropic	mdCR4-5-293
2D 1H-1H NOESY	D-mdCR4-5-H2O	isotropic	mdCR4-5-283
2D 1H-1H NOESY	D-mdCR4-5-D2O	isotropic	mdCR4-5-293
2D 1H-1H TOCSY	mdCR4-5-D2O	isotropic	mdCR4-5-293
3D HCCH-TOCSY	A-mdCR4-5-D2O	isotropic	mdCR4-5-293
3D HCCH-TOCSY	U-mdCR4-5-D2O	isotropic	mdCR4-5-293
3D HCCH-TOCSY	G-mdCR4-5-D2O	isotropic	mdCR4-5-293
3D HCCH-TOCSY	mdCR4-5-D2O	isotropic	mdCR4-5-293
2D HNN-COSY	FL-mdCR4-5-H2O	isotropic	mdCR4-5-283
2D 1H-1H filter/edited NOESY	A-mdCR4-5-D2O	isotropic	mdCR4-5-293
2D 1H-1H filter/edited NOESY	U-mdCR4-5-D2O	isotropic	mdCR4-5-293
2D 1H-1H filter/edited NOESY	G-mdCR4-5-D2O	isotropic	mdCR4-5-293
2D 1H-1H filter/edited NOESY	C-mdCR4-5-D2O	isotropic	mdCR4-5-293

Biological Magnetic Resonance Data Bank

BMRB Entry 19634

Title: Solution structure of the CR4/5 domain of medaka telomerase RNA PubMed: 24335084

Additional metadata:

Assembly:

Entities:

Samples:

Experiments:

Software:

NMR spectrometers: