BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 25163

Title: NMR structure of the III-IV-V three-way junction from the VS ribozyme   PubMed: 25238589

Deposition date: 2014-08-19 Original release date: 2014-10-14

Authors: Bonneau, Eric; Legault, Pascale

Citation: Bonneau, Eric; Legault, Pascale. "Nuclear Magnetic Resonance Structure of the III-IV-V Three-Way Junction from the Varkud Satellite Ribozyme and Identification of Magnesium-Binding Sites Using Paramagnetic Relaxation Enhancement."  Biochemistry 53, 6264-6275 (2014).

Assembly members:
RNA_(47-MER), polymer, 47 residues, 15118.061 Da.

Natural source:   Common Name: ascomycetes   Taxonomy ID: 5141   Superkingdom: Eukaryota   Kingdom: Fungi   Genus/species: Neurospora crassa

Experimental source:   Production method: recombinant technology   Host organism: Escherichia coli

Entity Sequences (FASTA):
RNA_(47-MER): GGACCUCCCGUCCUUGGACG GUCGAGCGAAAGCUUGUGAU UGGUCCG

Data sets:
Data typeCount
1H chemical shifts368
13C chemical shifts286
15N chemical shifts39

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all