BMRB Entry 25163
Click here to enlarge.
PDB ID: 2mtj
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR25163
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: NMR structure of the III-IV-V three-way junction from the VS ribozyme PubMed: 25238589
Deposition date: 2014-08-19 Original release date: 2014-10-14
Authors: Bonneau, Eric; Legault, Pascale
Citation: Bonneau, Eric; Legault, Pascale. "Nuclear Magnetic Resonance Structure of the III-IV-V Three-Way Junction from the Varkud Satellite Ribozyme and Identification of Magnesium-Binding Sites Using Paramagnetic Relaxation Enhancement." Biochemistry 53, 6264-6275 (2014).
Assembly members:
RNA_(47-MER), polymer, 47 residues, 15118.061 Da.
Natural source: Common Name: ascomycetes Taxonomy ID: 5141 Superkingdom: Eukaryota Kingdom: Fungi Genus/species: Neurospora crassa
Experimental source: Production method: recombinant technology Host organism: Escherichia coli
Entity Sequences (FASTA):
RNA_(47-MER): GGACCUCCCGUCCUUGGACG
GUCGAGCGAAAGCUUGUGAU
UGGUCCG
- assigned_chemical_shifts
| Data type | Count |
| 1H chemical shifts | 368 |
| 13C chemical shifts | 286 |
| 15N chemical shifts | 39 |