BMRB Entry 25427
Click here to enlarge.
PDB ID: 2mxs
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR25427
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: DNA/RNA (28-MER)
Deposition date: 2015-01-14 Original release date: 2015-12-07
Authors: Schmidtke, Sina; Duchardt-Ferner, Elke; Ohlenschlaeger, Oliver; Gottstein, Daniel; Wohnert, Jens
Citation: Schmidtke, Sina; Duchardt-Ferner, Elke; Ohlenschlaeger, Oliver; Gottstein, Daniel; Wohnert, Jens. "What a difference an OH makes: conformational dynamics as the basis for ligand specificity of the neomycin sensing riboswitch" Angew. Chem. Int. Ed. Engl. ., .-..
Assembly members:
RNA_(27-MER), polymer, 27 residues, 3295.044 Da.
PAROMOMYCIN, non-polymer, 615.628 Da.
Natural source: Common Name: not available Taxonomy ID: not available Superkingdom: not available Kingdom: not available Genus/species: not available not available
Experimental source: Production method: obtained from a collaborator Host organism: in vitro transcription
Entity Sequences (FASTA):
RNA_(27-MER): GGCUGCUUGUCCUUUAAUGG
UCCAGUC
| Data type | Count |
| 13C chemical shifts | 444 |
| 15N chemical shifts | 20 |
| 1H chemical shifts | 622 |