BMRB Entry 25526
Click here to enlarge.
PDB ID: 2n0j
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR25526
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: Re-refined solution NMR Structure of the 27 nucleotide engineered neomycin sensing riboswitch RNA-ribostamycin complex PubMed: 26661511
Deposition date: 2015-03-09 Original release date: 2016-02-01
Authors: Duchardt-Ferner, Elke; Gottstein-Schmidtke, Sina; Weigand, Julia; Ohlenschlaeger, Oliver; Wurm, Jan-Philip; Hammann, Christian; Suess, Beatrix; Woehnert, Jens
Citation: Elke, Duchardt-Ferner; Julia, Weigand; Oliver, Ohlenschlaeger; Sina, Schmidtke; Beatrix, Suess; Jens, Woehnert. "What a Difference an OH Makes: Conformational Dynamics as the Basis for the Ligand Specificity of the Neomycin-Sensing Riboswitch" Angew. Chem. Int. Ed. 55, 1527-1530 (2016).
Assembly members:
RNA_(27-MER), polymer, 27 residues, 8557.091 Da.
RIBOSTAMYCIN, non-polymer, 454.473 Da.
Natural source: Common Name: not available Taxonomy ID: not available Superkingdom: not available Kingdom: not available Genus/species: not available not available
Experimental source: Production method: reverse transcriptase
Entity Sequences (FASTA):
RNA_(27-MER): GGCUGCUUGUCCUUUAAUGG
UCCAGUC
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 180 |
| 15N chemical shifts | 27 |
| 1H chemical shifts | 205 |
| 31P chemical shifts | 8 |