BMRB Entry 25534
Click here to enlarge.
PDB ID: 2n0r
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR25534
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: RNA structure determination by solid-state NMR spectroscopy PubMed: 25960310
Deposition date: 2015-03-12 Original release date: 2015-05-08
Authors: Marchanka, Alexander; Simon, Bernd; Althoff-Ospelt, Gerhard; Carlomagno, Teresa
Citation: Marchanka, Alexander; Simon, Bernd; Althoff-Ospelt, Gerhard; Carlomagno, Teresa. "RNA structure determination by solid-state NMR spectroscopy" Nat. Commun. 6, 7024-7024 (2015).
Assembly members:
26mer Box C/D RNA, polymer, 26 residues, 7450.573 Da.
Natural source: Common Name: E. coli Taxonomy ID: 562 Superkingdom: Bacteria Kingdom: not available Genus/species: Escherichia coli
Experimental source: Production method: enzymatic semisynthesis
Entity Sequences (FASTA):
26mer Box C/D RNA: GCUGAGCUCGAAAGAGCAAU
GAUGUC
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 173 |
| 15N chemical shifts | 49 |
| 31P chemical shifts | 9 |