BMRB Entry 25603
Click here to enlarge.
PDB ID: 2n2o
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR25603
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: Structure of murine tumour necrosis factor alpha CDE RNA PubMed: 26165594
Deposition date: 2015-05-11 Original release date: 2015-08-03
Authors: Codutti, Luca; Leppek, Katrin; Zalesak, Jan; Windeisen, Volker; Masiewicz, Pawel; Stoecklin, Georg; Carlomagno, Teresa
Citation: Codutti, Luca; Leppek, Katrin; Zalesak, Jan; Windeisen, Volker; Masiewicz, Pawel; Stoecklin, Georg; Carlomagno, Teresa. "A Distinct, Sequence-Induced Conformation Is Required for Recognition of the Constitutive Decay Element RNA by Roquin" Structure 23, 1437-1447 (2015).
Assembly members:
RNA_(5'-R(P*GP*CP*AP*UP*GP*UP*UP*UP*UP*CP*UP*GP*UP*GP*AP*AP*AP*AP*CP*GP*GP*UP*U)-3'), polymer, 23 residues, 7343.398 Da.
Natural source: Common Name: not available Taxonomy ID: not available Superkingdom: not available Kingdom: not available Genus/species: not available not available
Experimental source: Production method: enzymatic semisynthesis
Entity Sequences (FASTA):
RNA_(5'-R(P*GP*CP*AP*UP*GP*UP*UP*UP*UP*CP*UP*GP*UP*GP*AP*AP*AP*AP*CP*GP*GP*UP*U)-3'): GCAUGUUUUCUGUGAAAACG
GUU
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 148 |
| 15N chemical shifts | 33 |
| 1H chemical shifts | 185 |
| 31P chemical shifts | 21 |