BMRB Entry 25686
Click here to enlarge.
PDB ID: 2n4y
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR25686
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: Structure of a G-quadruplex in the Long Terminal Repeat of the proviral HIV-1 genome PubMed: 27298260
Deposition date: 2015-07-02 Original release date: 2016-06-27
Authors: De Nicola, Beatrice; Lech, Christopher Jacques; Regmi, Sagar; Heddi, Brahim; Richter, Sara; Phan, Anh Tuan
Citation: de Nicola, Beatrice; Lech, Christopher Jacques; Regmi, Sagar; Heddi, Brahim; Richter, Sara; Phan, Anh Tuan. "Structure of a G-quadruplex in the Long Terminal Repeat of the proviral HIV-1 genome" Nucleic Acids Res. 44, 6442-6451 (2016).
Assembly members:
DNA_(5'-D(*CP*TP*GP*GP*GP*CP*GP*GP*GP*AP*CP*TP*GP*GP*GP*GP*AP*GP*TP*GP*GP*T)-3'), polymer, 22 residues, 6945.505 Da.
Natural source: Common Name: viruses Taxonomy ID: 12721 Superkingdom: Viruses Kingdom: not available Genus/species: Lentivirus not available
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
DNA_(5'-D(*CP*TP*GP*GP*GP*CP*GP*GP*GP*AP*CP*TP*GP*GP*GP*GP*AP*GP*TP*GP*GP*T)-3'): CTGGGCGGGACTGGGGAGTG
GT
- assigned_chemical_shifts
| Data type | Count |
| 1H chemical shifts | 209 |