BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 25780

Title: Structure of CssA4 (bottom stem) of CssA thermometer   PubMed: 27369378

Deposition date: 2015-08-28 Original release date: 2016-07-26

Authors: Barnwal, Ravi; Godin, Kate; Varani, Gabriele; Loh, Edmund; Yip, Jordan; Tang, Christoph

Citation: Barnwal, Ravi; Loh, Edmund; Godin, Kate; Yip, Jordan; Lavender, Hayley; Tang, Christoph; Varani, Gabriele. "Structure and mechanism of a molecular rheostat, an RNA thermometer that modulates immune evasion by Neisseria meningitidis"  Nucleic Acids Res. 44, 9426-9437 (2016).

Assembly members:
RNA_(36-MER), polymer, 36 residues, 11474.870 Da.

Natural source:   Common Name: b-proteobacteria   Taxonomy ID: 487   Superkingdom: Bacteria   Kingdom: not available   Genus/species: Neisseria meningitidis

Experimental source:   Production method: in vitro transcription

Entity Sequences (FASTA):
RNA_(36-MER): GGAAUUUAUGAGUACCUUCG GAUACUUAUAGAUUCC

Data sets:
Data typeCount
13C chemical shifts76
15N chemical shifts17
1H chemical shifts215

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all