BMRB Entry 25781
Click here to enlarge.
PDB ID: 2n6t
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR25781
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: NMR Assignment and NMR Structure of CssA3 (top stem) of CssA thermometer PubMed: 27369378
Deposition date: 2015-08-28 Original release date: 2016-07-26
Authors: Barnwal, Ravi; Godin, Kate; Varani, Gabriele; Loh, Edmund; Yip, Jordan; Tang, Christoph
Citation: Barnwal, Ravi; Loh, Edmund; Godin, Kate; Yip, Jordan; Lavender, Hayley; Tang, Christoph; Varani, Gabriele. "Structure and mechanism of a molecular rheostat, an RNA thermometer that modulates immune evasion by Neisseria meningitidis" Nucleic Acids Res. 44, 9426-9437 (2016).
Assembly members:
CssA3_RNA_(42-MER), polymer, 42 residues, 13348.949 Da.
Natural source: Common Name: b-proteobacteria Taxonomy ID: 487 Superkingdom: Bacteria Kingdom: not available Genus/species: Neisseria meningitidis
Experimental source: Production method: in vitro transcription
Entity Sequences (FASTA):
CssA3_RNA_(42-MER): GGGUAGAGUAUAAUUAGUCU
UCGGACUUCCUUAUACUUAU
CC
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 67 |
| 15N chemical shifts | 14 |
| 1H chemical shifts | 231 |