BMRB Entry 25785
Click here to enlarge.
PDB ID: 2n6x
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR25785
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: NMR Assignment and structure of CssA5 (middle region) of CssA thermometer from Neisseria meningitidis PubMed: 27369378
Deposition date: 2015-08-31 Original release date: 2016-07-26
Authors: Barnwal, Ravi; Godin, Kate; Varani, Gabriele
Citation: Barnwal, Ravi; Loh, Edmund; Godin, Kate; Yip, Jordan; Lavender, Hayley; Tang, Christoph; Varani, Gabriele. "Structure and mechanism of a molecular rheostat, an RNA thermometer that modulates immune evasion by Neisseria meningitidis" Nucleic Acids Res. 44, 9426-9437 (2016).
Assembly members:
CssA5_RNA_(43-MER), polymer, 43 residues, 13741.223 Da.
Natural source: Common Name: b-proteobacteria Taxonomy ID: 487 Superkingdom: Bacteria Kingdom: not available Genus/species: Neisseria meningitidis
Experimental source: Production method: in vitro transcription
Entity Sequences (FASTA):
CssA5_RNA_(43-MER): GGUGAGUACGUAGAGUAUAC
UUCGGUAUACUUAUAUACUU
ACC
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 32 |
| 15N chemical shifts | 18 |
| 1H chemical shifts | 204 |