BMRB Entry 25811
Click here to enlarge.
PDB ID: 2n7m
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR25811
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: NMR-SAXS/WAXS Structure of the core of the U4/U6 di-snRNA PubMed: 26655855
Deposition date: 2015-09-14 Original release date: 2015-12-28
Authors: Cornilescu, Gabriel; Didychuk, Allison; Rodgers, Margaret; Michael, Lauren; Burke, Jordan; Montemayor, Eric; Hoskins, Aaron; Butcher, Samuel; Tonelli, Marco
Citation: Cornilescu, Gabriel; Didychuk, Allison; Rodgers, Margaret; Michael, Lauren; Burke, Jordan; Montemayor, Eric; Hoskins, Aaron; Butcher, Samuel. "Structural analysis of multi-helical RNAs by NMR-SAXS/WAXS: Application to the U4/U6 di-snRNA" J. Mol. Biol. 428, 777-789 (2015).
Assembly members:
RNA_(92-MER), polymer, 92 residues, 29563.637 Da.
Natural source: Common Name: baker's yeast Taxonomy ID: 4932 Superkingdom: Eukaryota Kingdom: Fungi Genus/species: Saccharomyces cerevisiae
Experimental source: Production method: recombinant technology Host organism: Escherichia coli
Entity Sequences (FASTA):
RNA_(92-MER): GGCCUUAUGCACGGGAAAUA
CGCAUAUCAGUGAGGAUUCG
UCCGAGAUUGUGUUUUUGCU
GGUGUAAAUCAGCAGUUCCC
CUGCAUAAGGCU
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 5 |
| 15N chemical shifts | 25 |
| 1H chemical shifts | 30 |