BMRB Entry 25826
Click here to enlarge.
PDB ID: 2n7x
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR25826
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: solution structure of microRNA 20b pre-element PubMed: 27001519
Deposition date: 2015-09-25 Original release date: 2016-04-12
Authors: Yang, Fan; Chen, Yu; Varani, Gabriele
Citation: Chen, Yu; Zubovic, Lorena; Yang, Fan; Godin, Katherine; Pavelitz, Tom; Castellanos, Javier; Macchi, Paolo; Varani, Gabriele. "Rbfox proteins regulate microRNA biogenesis by sequence-specific binding to their precursors and target downstream Dicer" Nucleic Acids Res. 44, 4381-4395 (2016).
Assembly members:
miR-20b, polymer, 23 residues, Formula weight is not available
Natural source: Common Name: human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: T7 in vitro transcription Host organism: NA
Entity Sequences (FASTA):
miR-20b: GGUAGUUUUGGCAUGACUCU
ACC
- assigned_chemical_shifts
Data type | Count |
13C chemical shifts | 153 |
1H chemical shifts | 175 |