BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 25826

Title: solution structure of microRNA 20b pre-element   PubMed: 27001519

Deposition date: 2015-09-25 Original release date: 2016-04-12

Authors: Yang, Fan; Chen, Yu; Varani, Gabriele

Citation: Chen, Yu; Zubovic, Lorena; Yang, Fan; Godin, Katherine; Pavelitz, Tom; Castellanos, Javier; Macchi, Paolo; Varani, Gabriele. "Rbfox proteins regulate microRNA biogenesis by sequence-specific binding to their precursors and target downstream Dicer"  Nucleic Acids Res. 44, 4381-4395 (2016).

Assembly members:
miR-20b, polymer, 23 residues, Formula weight is not available

Natural source:   Common Name: human   Taxonomy ID: 9606   Superkingdom: Eukaryota   Kingdom: Metazoa   Genus/species: Homo sapiens

Experimental source:   Production method: T7 in vitro transcription   Host organism: NA

Entity Sequences (FASTA):
miR-20b: GGUAGUUUUGGCAUGACUCU ACC

Data sets:
Data typeCount
13C chemical shifts153
1H chemical shifts175

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all