BMRB Entry 25867
Click here to enlarge.
PDB ID: 2n8v
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR25867
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: An NMR/SAXS structure of the PKI domain of the honeybee dicistrovirus, Israeli acute paralysis virus (IAPV) IRES PubMed: 26554019
Deposition date: 2015-10-27 Original release date: 2015-11-09
Authors: Au, Hilda; Cornilescu, Gabriel; Mouzakis, Kathryn; Burke, Jordan; Ren, Qian; Lee, Seonghoon; Butcher, Samuel; Jan, Eric
Citation: Au, Hilda; Cornilescu, Gabriel; Mouzakis, Kathryn; Ren, Qian; Burke, Jordan; Lee, Seonghoon; Butcher, Samuel; Jan, Eric. "Global shape mimicry of tRNA within a viral internal ribosome entry site mediates translational reading frame selection" Proc. Natl. Acad. Sci. U.S.A. 112, E6446-E6455 (2015).
Assembly members:
RNA_(70-MER), polymer, 70 residues, 22565.592 Da.
Natural source: Common Name: honey bee Taxonomy ID: 7460 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Apis mellifera
Experimental source: Production method: cell free synthesis Host organism: E. coli - cell free
Entity Sequences (FASTA):
RNA_(70-MER): GGAACAGCUGUACUGGGCAG
UUACAGCAGUCGUAUGGUAA
CACAUGCGGCGUUCCGAAAU
ACCAUGCCUG
- assigned_chemical_shifts
| Data type | Count |
| 15N chemical shifts | 29 |
| 1H chemical shifts | 29 |