BMRB Entry 25998
Click here to enlarge.
PDB ID: 2nbz
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR25998
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: Solution structure of the K domain of EMCV IRES PubMed: 27525590
Deposition date: 2016-03-16 Original release date: 2016-08-08
Authors: Imai, Shunsuke; D'Souza, Victoria; Wagner, Gerhard
Citation: Imai, Shunsuke; Hellen, Christopher; D'Souza, Victoria; Wagner, Gerhard. "An accurately preorganized IRES RNA structure enables eIF4G capture for initiation of viral translation" Nat. Struct. Mol. Biol. 23, 859-864 (2016).
Assembly members:
RNA_(40-MER), polymer, 40 residues, 12798.640 Da.
Natural source: Common Name: Encephalomyocarditis virus Taxonomy ID: 12104 Superkingdom: Viruses Kingdom: not available Genus/species: Cardiovirus not available
Experimental source: Production method: enzymatic semisynthesis
Entity Sequences (FASTA):
RNA_(40-MER): GGGCUCGGUGCACAUGCUUU
ACAUGUGUUUAGUCGAGCCC
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 167 |
| 1H chemical shifts | 176 |