BMRB Entry 26024
Click here to enlarge.
PDB ID: 2nci
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR26024
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: RNA Bulge Loop that Specifically Binds Metal Ions PubMed: 27631837
Deposition date: 2016-04-08 Original release date: 2016-09-22
Authors: Gu, Xiaobo; Schroeder, Susan
Citation: Gu, Xiaobo; Park, Sun-Young; Tonelli, Marco; Cornilescu, Gabriel; Xia, Tianbing; Zhong, Dongping; Schroeder, Susan. "NMR Structures and Dynamics in a Prohead RNA Loop that Binds Metal Ions" J. Phys. Chem. Lett. ., 3841-3846 (2016).
Assembly members:
RNA_(28-MER), polymer, 28 residues, 8970.434 Da.
Natural source: Common Name: bacteriophage Taxonomy ID: 38018 Superkingdom: Viruses Kingdom: not available Genus/species: not available unidentified phage
Experimental source: Production method: enzymatic semisynthesis Host organism: Transcription of RNA using T7 polymerase
Entity Sequences (FASTA):
RNA_(28-MER): GGACGUUAAAAGGCUUCGGC
CUACGUCC
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 78 |
| 15N chemical shifts | 11 |
| 1H chemical shifts | 184 |