BMRB Entry 26568
Click here to enlarge.
PDB ID: 5a17
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR26568
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: The structure of the SOLE element of oskar mRNA PubMed: 26089324
Deposition date: 2015-04-28 Original release date: 2015-05-04
Authors: Simon, Bernd; Masiewicz, P.; Ephrussi, A.; Carlomagno, T.
Citation: Simon, Bernd; Masiewicz, P.; Ephrussi, A.; Carlomagno, T.. "The structure of the SOLE element of oskar mRNA" RNA 21, 1444-1453 (2015).
Assembly members:
OSKAR_MRNA, polymer, 32 residues, 10376.25762 Da.
Natural source: Common Name: fruit fly Taxonomy ID: 7227 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Drosophila melanogaster
Experimental source: Production method: recombinant technology Host organism: in vitro transcription
Entity Sequences (FASTA):
OSKAR_MRNA: GACGAUAUCGAGCAUCAAGA
GUGAAUAUCGUC
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 213 |
| 15N chemical shifts | 38 |
| 1H chemical shifts | 251 |
| 31P chemical shifts | 30 |