BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 27144

Title: DNA with compounds

Deposition date: 2017-06-16 Original release date: 2018-10-12

Authors: Chen, Xiang; Walters, Kylie

Citation: Chen, Xiang; Walters, Kylie. "DNA with compounds"  Nat. Commun. 9, .-. (2018).

Assembly members:
c-Myc_Pu22, polymer, 22 residues, Formula weight is not available
4-[(azepan-1-yl)methyl]-5-hydroxy-2-methyl-N-[4-(trifluoromethyl)phenyl]-1-benzofuran-3-carboxamide, non-polymer, 446.462 Da.

Natural source:   Common Name: Human   Taxonomy ID: 9606   Superkingdom: Eukaryota   Kingdom: Metazoa   Genus/species: Homo sapiens

Experimental source:   Production method: obtained from a collaborator   Host organism: N/A

Entity Sequences (FASTA):
c-Myc_Pu22: TGAGGGTGGGTAGGGTGGGT AA

Data sets:
Data typeCount
1H chemical shifts207

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all