BMRB Entry 27144
Click here to enlarge.
PDB ID: 5w77
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR27144
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: DNA with compounds
Deposition date: 2017-06-16 Original release date: 2018-10-12
Authors: Chen, Xiang; Walters, Kylie
Citation: Chen, Xiang; Walters, Kylie. "DNA with compounds" Nat. Commun. 9, .-. (2018).
Assembly members:
c-Myc_Pu22, polymer, 22 residues, Formula weight is not available
4-[(azepan-1-yl)methyl]-5-hydroxy-2-methyl-N-[4-(trifluoromethyl)phenyl]-1-benzofuran-3-carboxamide, non-polymer, 446.462 Da.
Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: obtained from a collaborator Host organism: N/A
Entity Sequences (FASTA):
c-Myc_Pu22: TGAGGGTGGGTAGGGTGGGT
AA
- assigned_chemical_shifts
Data type | Count |
1H chemical shifts | 207 |