BMRB Entry 27452
Click here to enlarge.
PDB ID: 6hag
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR27452
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: NMR resonance assignment for the SAM/SAH binding riboswitch RNA bound to S-Adenosylhomocysteine PubMed: 30051308
Deposition date: 2018-04-16 Original release date: 2018-08-09
Authors: Weickhmann, Anna Katharina; Keller, Heiko; Duchardt-Ferner, Elke; Wunderlich, Christoph; Juen, Michael; Kremser, Johannes; Kreutz, Christoph; Woehnert, Jens
Citation: Weickhmann, A Katharina; Keller, Heiko; Duchardt-Ferner, Elke; Strebitzer, Elisabeth; Juen, Michael; Kremser, Johannes; Wurm, Jan Philip; Kreutz, Christoph; Wohnert, Jens. "NMR resonance assignments for the SAM/SAH-binding riboswitch RNA bound to S-adenosylhomocysteine" Biomol. NMR Assign. 12, 329-334 (2018).
Assembly members:
env9b, polymer, 43 residues, Formula weight is not available
S-ADENOSYL-L-HOMOCYSTEINE, non-polymer, 384.411 Da.
Natural source: Common Name: not available Taxonomy ID: not available Superkingdom: not available Kingdom: not available Genus/species: not available not available
Experimental source: Production method: recombinant technology Host organism: Escherichia coli
Entity Sequences (FASTA):
env9b: GUCACAACGGCUUCCUGACG
UGGCAGAUUGAAUUAUUGGA
GCA
- assigned_chemical_shifts
Data type | Count |
13C chemical shifts | 313 |
15N chemical shifts | 126 |
1H chemical shifts | 318 |