BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 27452

Title: NMR resonance assignment for the SAM/SAH binding riboswitch RNA bound to S-Adenosylhomocysteine   PubMed: 30051308

Deposition date: 2018-04-16 Original release date: 2018-08-09

Authors: Weickhmann, Anna Katharina; Keller, Heiko; Duchardt-Ferner, Elke; Wunderlich, Christoph; Juen, Michael; Kremser, Johannes; Kreutz, Christoph; Woehnert, Jens

Citation: Weickhmann, A Katharina; Keller, Heiko; Duchardt-Ferner, Elke; Strebitzer, Elisabeth; Juen, Michael; Kremser, Johannes; Wurm, Jan Philip; Kreutz, Christoph; Wohnert, Jens. "NMR resonance assignments for the SAM/SAH-binding riboswitch RNA bound to S-adenosylhomocysteine"  Biomol. NMR Assign. 12, 329-334 (2018).

Assembly members:
env9b, polymer, 43 residues, Formula weight is not available
S-ADENOSYL-L-HOMOCYSTEINE, non-polymer, 384.411 Da.

Natural source:   Common Name: not available   Taxonomy ID: not available   Superkingdom: not available   Kingdom: not available   Genus/species: not available not available

Experimental source:   Production method: recombinant technology   Host organism: Escherichia coli

Entity Sequences (FASTA):
env9b: GUCACAACGGCUUCCUGACG UGGCAGAUUGAAUUAUUGGA GCA

Data sets:
Data typeCount
13C chemical shifts313
15N chemical shifts126
1H chemical shifts318

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Related Database Links:

EMBL RF01727