BMRB Entry 28094
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR28094
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: Solution NMR structure of 5'UTR of Stem loop B in DENV4 PubMed: 32807496
Deposition date: 2020-03-06 Original release date: 2020-08-18
Authors: Sharma, Shrikant; Varani, Gabriele
Citation: Sharma, Shrikant; Varani, Gabriele. "NMR structure of Dengue West Nile viruses stem-loop B: A key cis-acting element for flavivirus replication" Biochem. Biophys. Res. Commun. ., .-. (2020).
Assembly members:
DENV4, polymer, 41 residues, Formula weight is not available
Natural source: Common Name: Flavivirus Taxonomy ID: 11051 Superkingdom: Viruses Kingdom: not available Genus/species: Flavivirus not available
Experimental source: Production method: reverse transcriptase Host organism: Dengue virus
Entity Sequences (FASTA):
DENV4: GGUUUGUUUGAAUAGAGAGC
AGAUCUCUGGAAAAAUGAAC
C
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 265 |
| 15N chemical shifts | 18 |
| 1H chemical shifts | 327 |