BMRB Entry 30012
Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR30012
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: NMR structure of a new G-quadruplex forming sequence within the KRAS proto-oncogene promoter region PubMed: 28330874
Deposition date: 2016-02-09 Original release date: 2016-03-14
Authors: Salgado, G.; Kerkour, A.; Mergny, J.-L.
Citation: Kerkour, Abdelaziz; Marquevielle, Julien; Ivashchenko, Stefaniia; Yatsunyk, Liliya; Mergny, Jean-Louis; Salgado, Gilmar. "High-resolution three-dimensional NMR structure of the KRAS proto-oncogene promoter reveals key features of a G-quadruplex involved in transcriptional regulation" J. Biol. Chem. 292, 8082-8091 (2017).
Assembly members:
DNA (5'-D(*AP*GP*GP*GP*CP*GP*GP*TP*GP*TP*GP*GP*GP*AP*AP*TP*AP*GP*GP*GP*AP*A)-3'), polymer, 22 residues, 6986.514 Da.
POTASSIUM ION, non-polymer, 39.098 Da.
Natural source: Common Name: human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: homo not available
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
DNA (5'-D(*AP*GP*GP*GP*CP*GP*GP*TP*GP*TP*GP*GP*GP*AP*AP*TP*AP*GP*GP*GP*AP*A)-3'): AGGGCGGTGTGGGAATAGGG
AA
- assigned_chemical_shifts
| Data type | Count |
| 1H chemical shifts | 218 |