BMRB Entry 30026
Click here to enlarge.
PDB ID: 5iem
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR30026
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: NMR structure of the 5'-terminal hairpin of the 7SK snRNA PubMed: 27852926
Deposition date: 2016-02-25 Original release date: 2016-10-28
Authors: Bourbigot, S.; Dock-Bregeon, A.C.; Coutant, J.; Kieffer, B.; Lebars, I.
Citation: Bourbigot, S.; Dock-Bregeon, A.C.; Eberling, P.; Coutant, J.; Kieffer, B.; Lebars, I.. "Solution structure of the 5'-terminal hairpin of the 7SK small nuclear RNA" RNA 22, 1844-1858 (2016).
Assembly members:
RNA (57-MER), polymer, 57 residues, 18268.777 Da.
Natural source: Common Name: not available Taxonomy ID: 32630 Superkingdom: not available Kingdom: not available Genus/species: not available not available
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
RNA (57-MER): GGGAUCUGUCACCCCAUUGA
UCGCCUUCGGGCUGAUCUGG
CUGGCUAGGCGGGUCCC
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 68 |
| 15N chemical shifts | 23 |
| 1H chemical shifts | 256 |