BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 30046

Title: Ground state sampled during RDC restrained Replica-averaged Metadynamics (RAM) simulations of the HIV-1 TAR complexed with cyclic peptide mimetic of Tat   PubMed: 7286828

Deposition date: 2016-03-28 Original release date: 2016-06-06

Authors: Borkar, A.; Bardaro Jr., M.F.; Varani, G.; Vendrucolo, M.

Citation: Borkar, A.; Bardaro, M.; Camilloni, C.; Aprile, F.; Varani, G.; Vendrucolo, M.. "Structure of a low-population binding intermediate in protein-RNA recognition"  Proc. Natl. Acad. Sci. U. S. A. 113, 7171-7176 (2016).

Assembly members:
Cyclic peptide mimetic of HIV-1 Tat, polymer, 14 residues, 1768.189 Da.
Apical region (29-mer) of the HIV-1 TAR RNA element, polymer, 29 residues, 9307.555 Da.

Natural source:   Common Name: HIV-1   Taxonomy ID: 11676   Superkingdom: Viruses   Kingdom: not available   Genus/species: Lentivirus HIV-1

Experimental source:   Production method: chemical synthesis

Entity Sequences (FASTA):
Cyclic peptide mimetic of HIV-1 Tat: RVRTRKGRRIRIXP
Apical region (29-mer) of the HIV-1 TAR RNA element: GGCAGAUCUGAGCCUGGGAG CUCUCUGCC

Data sets:
Data typeCount
13C chemical shifts162
1H chemical shifts389

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all