BMRB Entry 30058
Click here to enlarge.
PDB ID: 5j6u
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR30058
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: DIY G-Quadruplexes: Solution Structure of d(GGGGTTTGGGGTTTTGGGGAAGGGG) in sodium PubMed: 30182059
Deposition date: 2016-04-05 Original release date: 2017-05-04
Authors: Dvorkin, S.; Karsisiotis, A.; Webba da Silva, M.
Citation: Dvorkin, Scarlett; Karsisiotis, Andreas; Webba da Silva, Mateus. "Encoding canonical DNA quadruplex structure." Sci Adv 4, eaat3007-eaat3007 (2018).
Assembly members:
DNA (25-MER), polymer, 25 residues, 7978.100 Da.
Natural source: Common Name: not available Taxonomy ID: 32644 Superkingdom: not available Kingdom: not available Genus/species: not available not available
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
DNA (25-MER): GGGGTTTGGGGTTTTGGGGA
AGGGG
- assigned_chemical_shifts
| Data type | Count |
| 1H chemical shifts | 256 |