BMRB Entry 30108
Click here to enlarge.
PDB ID: 5kh8
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR30108
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: Solution structures of the apo state fluoride riboswitch
Deposition date: 2016-06-14 Original release date: 2017-07-14
Authors: Zhang, Q.; Zhao, B.
Citation: Zhang, Q.; Zhao, B.. "Solution structures of the apo state fluoride riboswitch" . ., .-..
Assembly members:
riboswitch (47-MER), polymer, 47 residues, 15053.960 Da.
Natural source: Common Name: not available Taxonomy ID: 32630 Superkingdom: not available Kingdom: not available Genus/species: not available not available
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
riboswitch (47-MER): GGCGAUGGUGUUCGCCAUAA
ACGCUCUUCGGAGCUAAUGA
CACCUAC
- assigned_chemical_shifts
Data type | Count |
13C chemical shifts | 240 |
15N chemical shifts | 19 |
1H chemical shifts | 289 |