BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 30108

Title: Solution structures of the apo state fluoride riboswitch

Deposition date: 2016-06-14 Original release date: 2017-07-14

Authors: Zhang, Q.; Zhao, B.

Citation: Zhang, Q.; Zhao, B.. "Solution structures of the apo state fluoride riboswitch"  . ., .-..

Assembly members:
riboswitch (47-MER), polymer, 47 residues, 15053.960 Da.

Natural source:   Common Name: not available   Taxonomy ID: 32630   Superkingdom: not available   Kingdom: not available   Genus/species: not available not available

Experimental source:   Production method: chemical synthesis

Entity Sequences (FASTA):
riboswitch (47-MER): GGCGAUGGUGUUCGCCAUAA ACGCUCUUCGGAGCUAAUGA CACCUAC

Data sets:
Data typeCount
13C chemical shifts240
15N chemical shifts19
1H chemical shifts289

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all