BMRB Entry 30132
Click here to enlarge.
PDB ID: 5kqe
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR30132
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: Solution structure of P2a-J2a/b-P2b of medaka telomerase RNA PubMed: 27531956
Deposition date: 2016-07-06 Original release date: 2016-08-22
Authors: Wang, Y.; Feigon, J.
Citation: Wang, Y.; Yesselman, J.; Zhang, Q.; Kang, M.; Feigon, J.. "Structural conservation in the template/pseudoknot domain of vertebrate telomerase RNA from teleost fish to human" Proc. Natl. Acad. Sci. U. S. A. 113, E5125-E5134 (2016).
Assembly members:
entity_1, polymer, 36 residues, 11464.795 Da.
Natural source: Common Name: Japanese medaka Taxonomy ID: 8090 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Oryzias latipes
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: GGGUGUACUUAACGUUUGCU
UCGGCAAACUACAUCC
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 206 |
| 15N chemical shifts | 37 |
| 1H chemical shifts | 272 |