BMRB Entry 30224
Click here to enlarge.
PDB ID: 5uf3
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR30224
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: Structure Effects of the Four-Adenine Loop of the Coliphage GA Replicase RNA Operator PubMed: 28488852
Deposition date: 2017-01-03 Original release date: 2017-05-25
Authors: Chang, A.; Tran, M.; DeJong, E.; Nikonowicz, E.
Citation: Chang, A.; Tran, M.; Nikonowicz, E.. "Structure and Dynamics of the Tetra-A Loop and (A-A)-U Sequence Motif within the Coliphage GA Replicase RNA Operator" Biochemistry 56, 2690-2700 (2017).
Assembly members:
phage GA operator RNA hairpin, polymer, 23 residues, 7394.496 Da.
Natural source: Common Name: Enterobacteria phage GA Taxonomy ID: 12018 Superkingdom: Viruses Kingdom: not available Genus/species: Levivirus Escherichia virus BZ13
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
phage GA operator RNA hairpin: GGACAUAAGGAAAACCUAUG
UCC
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 158 |
| 15N chemical shifts | 49 |
| 1H chemical shifts | 196 |
| 31P chemical shifts | 21 |