BMRB Entry 30452
Click here to enlarge.
PDB ID: 6d2u
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR30452
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: Solution structure of a ultra-high affinity macrocycle bound to HIV-1 TAR RNA PubMed: 30481318
Deposition date: 2018-04-13 Original release date: 2018-12-04
Authors: Shortridge, M.; Varani, G.
Citation: Shortridge, M.; Wille, P.; Jones, A.; Davidson, A.; Bogdanovic, J.; Arts, E.; Karn, J.; Robinson, J.; Varani, G.. "An ultra-high affinity ligand of HIV-1 TAR reveals the RNA structure recognized by P-TEFb" Nucleic Acids Res. 47, 1523-1531 (2019).
Assembly members:
entity_1, polymer, 14 residues, 1697.087 Da.
entity_2, polymer, 29 residues, 9307.555 Da.
Natural source: Common Name: not available Taxonomy ID: 32630 Superkingdom: not available Kingdom: not available Genus/species: not available not available
Experimental source: Production method: recombinant technology Host organism: synthetic construct
Entity Sequences (FASTA):
entity_1: XVRTRKGRRIXIXP
entity_2: GGCAGAUCUGAGCCUGGGAG
CUCUCUGCC
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 171 |
| 15N chemical shifts | 11 |
| 1H chemical shifts | 338 |