BMRB Entry 30533
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR30533
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: Solution structure of a c-JUN 5' UTR stem-loop associated with specialized cap-dependent translation initiation
Deposition date: 2018-10-31 Original release date: 2020-05-04
Authors: Walker, M.; Shortridge, M.; Varani, G.
Citation: Walker, M.; Shortridge, M.; Albin, D.; Cominsky, L.; Varani, G.. "Solution structure of a c-JUN 5' UTR stem-loop associated with specialized cap-dependent translation initiation" . ., .-..
Assembly members:
entity_1, polymer, 49 residues, 15523.181 Da.
Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: GGCAGUAUAGUCCGAACUGC
AACUUCGGUUCACCUUCUCU
CUAACUGCC
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 332 |
| 15N chemical shifts | 14 |
| 1H chemical shifts | 419 |