BMRB Entry 30552
Click here to enlarge.
PDB ID: 6neb
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR30552
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: MYC Promoter G-Quadruplex with 1:6:1 loop length
Deposition date: 2018-12-17 Original release date: 2019-02-08
Authors: Dickerhoff, J.; Onel, B.; Chen, L.; Chen, Y.; Yang, D.
Citation: Dickerhoff, J.; Onel, B.; Chen, L.; Chen, Y.; Yang, D.. "Solution Structure of a MYC Promoter G-Quadruplex with 1:6:1 Loop Length" Acs Omega 4, 2533-2539 (2019).
Assembly members:
entity_1, polymer, 27 residues, 8563.501 Da.
Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: TTGGGGAGGGTTTTAAGGGT
GGGGAAT
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 32 |
| 1H chemical shifts | 260 |