BMRB Entry 30577
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR30577
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: NMR structure of the 2:1 complex of a carbazole derivative BMVC bound to c-MYC G-quadruplex
Deposition date: 2019-02-24 Original release date: 2019-10-18
Authors: Lin, C.; Liu, W.; Yang, D.
Citation: Liu, W.; Lin, C.; Wu, G.; Chang, T.; Yang, D.. "Solution structures of the c-MYC Promoter G-quadruplex bound to a carbazole derivative: Insights into small molecule conformational switch for optimal G4-binding" . ., .-..
Assembly members:
entity_1, polymer, 22 residues, 7008.510 Da.
entity_BO6, non-polymer, 403.518 Da.
Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: TGAGGGTGGGTAGGGTGGGT
AA
- assigned_chemical_shifts
| Data type | Count |
| 1H chemical shifts | 253 |