BMRB Entry 30622
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR30622
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: Solution Structure of lncRNA (LINK-A) 20-nt Hexaloop Hairpin
Deposition date: 2019-06-28 Original release date: 2020-06-26
Authors: Amado, A.; Walker, M.; Varani, G.
Citation: Amado, A.; Walker, M.; Varani, G.. "Structure of the lncRNA LINK-A Hexaloop Hairpin in PI(3,4,5)P3 Interaction" . ., .-..
Assembly members:
entity_1, polymer, 20 residues, 6414.854 Da.
Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: GGAGGGUAGACUCGCUCUCC
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 109 |
| 15N chemical shifts | 8 |
| 1H chemical shifts | 163 |
Additional metadata:
Assembly:
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | entity_1 | 1 |
Entities:
Entity 1, entity_1 20 residues - 6414.854 Da.
| 1 | G | G | A | G | G | G | U | A | G | A | |
| 2 | C | U | C | G | C | U | C | U | C | C |
Samples:
sample_1: RNA 0.9 mM; Sodium Phosphate 20 mM; EDTA 0.01 mM
sample_2: RNA 0.6 mM; Sodium Phosphate 20 mM; EDTA 0.01 mM
sample_3: RNA, [U-13C; U-15N], 0.5 mM; Sodium Phosphate 20 mM; EDTA 0.01 mM
sample_4: RNA, [U-13C; U-15N], 0.5 mM; Sodium Phosphate 20 mM; EDTA 0.01 mM
sample_conditions_1: pH: 6.0; pressure: 1 atm; temperature: 278 K
sample_conditions_2: pH: 6.0; pressure: 1 atm; temperature: 298 K
sample_conditions_3: pH: 6.0; pressure: 1 atm; temperature: 298 K
Experiments:
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-1H TOCSY | sample_2 | isotropic | sample_conditions_2 |
| 2D 1H-1H NOESY | sample_2 | isotropic | sample_conditions_2 |
| 2D 1H-1H NOESY | sample_2 | isotropic | sample_conditions_3 |
| 2D 1H-15N HSQC | sample_3 | isotropic | sample_conditions_1 |
| 2D 1H-13C HSQC | sample_4 | isotropic | sample_conditions_2 |
Software:
TopSpin, Bruker Biospin - processing
X-PLOR NIH, Schwieters, Kuszewski, Tjandra and Clore - refinement, structure calculation
Sparky, Goddard - chemical shift assignment, peak picking
NMR spectrometers:
- Bruker AVANCE III 800 MHz
- Bruker AVANCE III 600 MHz