BMRB Entry 30622
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR30622
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: Solution Structure of lncRNA (LINK-A) 20-nt Hexaloop Hairpin
Deposition date: 2019-06-28 Original release date: 2020-06-26
Authors: Amado, A.; Walker, M.; Varani, G.
Citation: Amado, A.; Walker, M.; Varani, G.. "Structure of the lncRNA LINK-A Hexaloop Hairpin in PI(3,4,5)P3 Interaction" . ., .-..
Assembly members:
entity_1, polymer, 20 residues, 6414.854 Da.
Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: GGAGGGUAGACUCGCUCUCC
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 109 |
| 15N chemical shifts | 8 |
| 1H chemical shifts | 163 |