BMRB Entry 30665
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR30665
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: NMR assignment and RNA structure of 5' UTR region stem loop from West Nile Virus PubMed: 32807496
Deposition date: 2019-09-01 Original release date: 2020-08-18
Authors: Sharma, S.; Varani, G.
Citation: Sharma, S.; Varani, G.. "NMR structure of Dengue West Nile viruses stem-loop B: A key cis-acting element for flavivirus replication" Biochem. Biophys. Res. Commun. ., .-. (2020).
Assembly members:
entity_1, polymer, 37 residues, 11841.064 Da.
Natural source: Common Name: West Nile virus Taxonomy ID: 11082 Superkingdom: Viruses Kingdom: not available Genus/species: Flavivirus West Nile virus
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: GGUUUCUUAGCACGAAGAUC
UCGAUGUCUAAGAAACC
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 215 |
| 15N chemical shifts | 13 |
| 1H chemical shifts | 277 |