BMRB Entry 30730
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR30730
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: Tandem UU:GA mismatch within an RNA helix PubMed: 32786414
Deposition date: 2020-02-28 Original release date: 2020-08-31
Authors: Nikonowicz, E.; Chang, A.
Citation: Chang, A.; Chen, L.; Song, L.; Zhang, S.; Nikonowicz, E.. "2-Amino-1,3-benzothiazole-6-carboxamide Preferentially Binds the Tandem Mismatch Motif r(UY:GA)" Biochemistry ., .-. (2020).
Assembly members:
entity_1, polymer, 28 residues, 8963.334 Da.
Natural source: Common Name: not available Taxonomy ID: 32630 Superkingdom: not available Kingdom: not available Genus/species: not available not available
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: GGGCUGUGAUGCUUCGGCAU
AUCAGCCC
- assigned_chemical_shifts
Data type | Count |
13C chemical shifts | 215 |
15N chemical shifts | 51 |
1H chemical shifts | 239 |