BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 30730

Title: Tandem UU:GA mismatch within an RNA helix   PubMed: 32786414

Deposition date: 2020-02-28 Original release date: 2020-08-31

Authors: Nikonowicz, E.; Chang, A.

Citation: Chang, A.; Chen, L.; Song, L.; Zhang, S.; Nikonowicz, E.. "2-Amino-1,3-benzothiazole-6-carboxamide Preferentially Binds the Tandem Mismatch Motif r(UY:GA)"  Biochemistry ., .-. (2020).

Assembly members:
entity_1, polymer, 28 residues, 8963.334 Da.

Natural source:   Common Name: not available   Taxonomy ID: 32630   Superkingdom: not available   Kingdom: not available   Genus/species: not available not available

Experimental source:   Production method: chemical synthesis

Entity Sequences (FASTA):
entity_1: GGGCUGUGAUGCUUCGGCAU AUCAGCCC

Data sets:
Data typeCount
13C chemical shifts215
15N chemical shifts51
1H chemical shifts239

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all