BMRB Entry 30788
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR30788
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: The FARFAR-NMR Ensemble of 29-mer HIV-1 Trans-activation Response Element RNA (N=20)
Deposition date: 2020-08-18 Original release date: 2020-10-05
Authors: Shi, H.; Rangadurai, A.; Roy, R.; Yesselman, J.; Al-Hashimi, H.
Citation: Shi, H.; Rangadurai, A.; Abou-Assi, H.; Roy, R.; Case, D.; Herschlag, D.; Yesselman, J.; Al-Hashimi, H.. "Rapid and accurate determination of atomistic RNA dynamic ensemble models using NMR and structure prediction" . ., .-..
Assembly members:
entity_1, polymer, 29 residues, 9307.555 Da.
Natural source: Common Name: HIV-1 Taxonomy ID: 11676 Superkingdom: Viruses Kingdom: not available Genus/species: Lentivirus HIV-1
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: GGCAGAUCUGAGCCUGGGAG
CUCUCUGCC
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 191 |
| 15N chemical shifts | 8 |
| 1H chemical shifts | 222 |