BMRB Entry 34210
Click here to enlarge.
PDB ID: 6f4z
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR34210
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: 2'F-araG modified quadruplex with flipped G-tract and central tetrad PubMed: 29460996
Deposition date: 2017-11-30 Original release date: 2018-04-20
Authors: Dickerhoff, J.; Weisz, K.
Citation: Dickerhoff, J.; Weisz, K.. "Fluorine-Mediated Editing of a G-Quadruplex Folding Pathway." Chembiochem 19, 927-930 (2018).
Assembly members:
entity_1, polymer, 22 residues, 6990.482 Da.
Natural source: Common Name: not available Taxonomy ID: 32630 Superkingdom: not available Kingdom: not available Genus/species: not available not available
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: GGGATGGGACACAGGGGACG
GG
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 24 |
| 1H chemical shifts | 143 |