BMRB Entry 34221
Click here to enlarge.
PDB ID: 6fc9
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR34221
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: The 1,8-bis(aminomethyl)anthracene and Quadruplex-duplex junction complex
Deposition date: 2017-12-20 Original release date: 2019-04-03
Authors: Santana, A.; Serrano, I.; Montalvillo-Jimenez, L.; Corzana, F.; Bastida, A.; Jimenez-Barbero, J.; Gonzalez, C.; Asensio, J.
Citation: Santana, A.; Serrano, I.; Montalvillo-Jimenez, L.; Corzana, F.; Bastida, A.; Jimenez-Barbero, J.; Gonzalez, C.; Asensio, J.. "Minimalistic scaffolds for the selective recognition of Quad-ruplex-Duplex Junctions: Targeting the G4 Hot-Spot" . ., .-..
Assembly members:
entity_1, polymer, 27 residues, 8445.403 Da.
entity_D5B, non-polymer, 236.312 Da.
Natural source: Common Name: not available Taxonomy ID: 32630 Superkingdom: not available Kingdom: not available Genus/species: not available not available
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: GGTTGGCGCGAAGCATTCGC
GGGTTGG
- assigned_chemical_shifts
| Data type | Count |
| 1H chemical shifts | 233 |