BMRB Entry 34228
Click here to enlarge.
PDB ID: 6ffr
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR34228
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: DNA-RNA Hybrid Quadruplex with Flipped Tetrad
Deposition date: 2018-01-09 Original release date: 2018-09-19
Authors: Haase, L.; Dickerhoff, J.; Weisz, K.
Citation: Haase, L.; Dickerhoff, J.; Weisz, K.. "DNA-RNA Hybrid Quadruplex with Flipped Tetrad" . ., .-..
Assembly members:
entity_1, polymer, 22 residues, 7004.491 Da.
Natural source: Common Name: not available Taxonomy ID: 32630 Superkingdom: not available Kingdom: not available Genus/species: not available not available
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: GGGATGGGACACAGGGGACG
GG
- assigned_chemical_shifts
- spectral_peak_list
| Data type | Count |
| 13C chemical shifts | 21 |
| 1H chemical shifts | 142 |