BMRB Entry 34321
Click here to enlarge.
PDB ID: 6hyk
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR34321
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: NMR solution structure of the C/D box snoRNA U14 PubMed: 30914254
Deposition date: 2018-10-22 Original release date: 2019-04-22
Authors: Chagot, M.; Quinternet, M.; Rothe, B.; Charpentier, B.; Coutant, J.; Manival, X.; Lebars, I.
Citation: Chagot, M.; Quinternet, M.; Rothe, B.; Charpentier, B.; Coutant, J.; Manival, X.; Lebars, I.. "The yeast C/D box snoRNA U14 adopts a "weak" K-turn like conformation recognized by the Snu13 core protein in solution." Biochimie ., .-. (2019).
Assembly members:
entity_1, polymer, 31 residues, 9998.949 Da.
Natural source: Common Name: not available Taxonomy ID: 32630 Superkingdom: not available Kingdom: not available Genus/species: not available not available
Experimental source: Production method: recombinant technology
Entity Sequences (FASTA):
entity_1: GGCACGGUGAUGACCUUCGG
GUCUGAGUGCC
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 207 |
| 15N chemical shifts | 77 |
| 1H chemical shifts | 242 |
| 31P chemical shifts | 11 |