BMRB Entry 34441
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR34441
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: NMR structure of KRAS32R G25T conformer G-quadruplex within KRAS promoter region
Deposition date: 2019-10-08 Original release date: 2020-01-31
Authors: Marquevielle, J.; Salgado, G.
Citation: Marquevielle, J.; Robert, C.; Lagrabette, O.; Wahid, M.; Bourdoncle, A.; Xodo, L.; Mergny, J.; Salgado, G.. "Structure of Multiple G-quadruplexes in equilibrium in KRAS promoter region" . ., .-..
Assembly members:
entity_1, polymer, 32 residues, 10246.573 Da.
entity_K, non-polymer, 39.098 Da.
Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: AGGGCGGTGTGGGAAGAGGG
AAGATGGGGAGG
- assigned_chemical_shifts
- spectral_peak_list
| Data type | Count |
| 13C chemical shifts | 34 |
| 15N chemical shifts | 12 |
| 1H chemical shifts | 258 |