BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 34482

Title: Constitutive decay element CDE2 from human 3'UTR

Deposition date: 2020-01-23 Original release date: 2020-05-25

Authors: Schwalbe, H.; Binas, O.

Citation: Binas, O.; Tants, J.; Peter, S.; Janowski, R.; Davydova, E.; Braun, J.; Niessing, D.; Schwalbe, H.; Weigand, J.; Schlundt, A.. "Structural basis for the recognition of transiently structured AU-rich elements by Roquin"  Nucleic Acids Res. ., .-. (2020).

Assembly members:
entity_1, polymer, 21 residues, 6690.004 Da.

Natural source:   Common Name: Human   Taxonomy ID: 9606   Superkingdom: Eukaryota   Kingdom: Metazoa   Genus/species: Homo sapiens

Experimental source:   Production method: chemical synthesis

Entity Sequences (FASTA):
entity_1: GGUGCCUAAUAUUUAGGCAC C

Data sets:
Data typeCount
13C chemical shifts94
1H chemical shifts159

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all