BMRB Entry 36116
Click here to enlarge.
PDB ID: 5yey
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR36116
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: The structure of a chair-type G-quadruplex of the human telomeric variant in K+ solution PubMed: 30713633
Deposition date: 2017-09-20 Original release date: 2018-09-24
Authors: Liu, C.; Zhou, B.; Kuryavyi, V.; Zhu, G.
Citation: Liu, Changdong; Zhou, Bo; Geng, Yanyan; Yan Tam, Dick; Feng, Rui; Miao, Haitao; Xu, Naining; Shi, Xiao; You, Yingying; Hong, Yuning; Tang, Ben Zhong; Kwan Lo, Pik; Kuryavyi, Vitaly; Zhu, Guang. "A chair-type G-quadruplex structure formed by a human telomeric variant DNA in K" Chem. Sci. 10, 218-226 (2019).
Assembly members:
DNA (5'-D(*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*TP*GP*GP*G)-3'), polymer, 21 residues, 6661.276 Da.
Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
DNA (5'-D(*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*TP*GP*GP*G)-3'): GGGTTAGGGTTAGGGTTTGG
G
- assigned_chemical_shifts
Data type | Count |
1H chemical shifts | 175 |