BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 36116

Title: The structure of a chair-type G-quadruplex of the human telomeric variant in K+ solution   PubMed: 30713633

Deposition date: 2017-09-20 Original release date: 2018-09-24

Authors: Liu, C.; Zhou, B.; Kuryavyi, V.; Zhu, G.

Citation: Liu, Changdong; Zhou, Bo; Geng, Yanyan; Yan Tam, Dick; Feng, Rui; Miao, Haitao; Xu, Naining; Shi, Xiao; You, Yingying; Hong, Yuning; Tang, Ben Zhong; Kwan Lo, Pik; Kuryavyi, Vitaly; Zhu, Guang. "A chair-type G-quadruplex structure formed by a human telomeric variant DNA in K"  Chem. Sci. 10, 218-226 (2019).

Assembly members:
DNA (5'-D(*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*TP*GP*GP*G)-3'), polymer, 21 residues, 6661.276 Da.

Natural source:   Common Name: Human   Taxonomy ID: 9606   Superkingdom: Eukaryota   Kingdom: Metazoa   Genus/species: Homo sapiens

Experimental source:   Production method: chemical synthesis

Entity Sequences (FASTA):
DNA (5'-D(*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*TP*GP*GP*G)-3'): GGGTTAGGGTTAGGGTTTGG G

Data sets:
Data typeCount
1H chemical shifts175

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all