BMRB Entry 4120
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR4120
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: NMR Structure of a Classical Pseudoknot: Interplay of Single- and Double-Stranded RNA PubMed: 9545221
Deposition date: 1998-03-05 Original release date: 2001-06-19
Authors: Kolk, M.; Van der Graaf, M.; Wijmenga, S.; Pleij, C.; Heus, H.; Hilbers, C.
Citation: Kolk, M.; Van der Graaf, M.; Wijmenga, S.; Pleij, C.; Heus, H.; Hilbers, C.. "NMR Structure of a Classical Pseudoknot: Interplay of Single- and Double-Stranded RNA" Science 280, 434-438 (1998).
Assembly members:
TYMV pseudoknot, polymer, 44 residues, Formula weight is not available
Natural source: Common Name: TYMV Taxonomy ID: 12154 Superkingdom: not available Kingdom: not available Genus/species: Tymovirus Turnip yellow mosaic virus
Experimental source: Production method: enzymatic synthesis
Entity Sequences (FASTA):
TYMV pseudoknot: GGGAGCUCAACUCUCCCCCC
CUUUUCCGAGGGUCAUCGGA
ACCA
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 297 |
| 1H chemical shifts | 339 |