BMRB Entry 4175
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR4175
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: SL3 Hairpin from the Packaging Signal of HIV-1
Deposition date: 1998-08-11 Original release date: 2000-04-04
Authors: Pappalardo, L.; Kerwood, D.; Pelczer, I.; Borer, P.
Citation: Pappalardo, L.; Kerwood, D.; Pelczer, I.; Borer, P.. "Three-dimensional Folding of an RNA Hairpin Required for Packaging HIV-1" J. Mol. Biol. 282, 801-818 (1998).
Assembly members:
SL3 RNA hairpin, polymer, 20 residues, Formula weight is not available
Natural source: Common Name: Human Immunodeficiency virus, type 1 Taxonomy ID: 11676 Superkingdom: virus Kingdom: not available Genus/species: not available not available
Experimental source: Production method: recombinant technology
Entity Sequences (FASTA):
SL3 RNA hairpin: GGACUAGCGGAGGCUAGUCC
- assigned_chemical_shifts
| Data type | Count |
| 31P chemical shifts | 19 |