BMRB Entry 4250
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR4250
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: Structure of the 3' hairpin of the TYMV pseudoknot: Preformation in RNA folding
Deposition date: 1998-10-15 Original release date: 2000-02-25
Authors: Kolk, M.; van der Graaf, M.; Fransen, C.; Wijmenga, S.; Pleij, C.; Heus, H.; Hilbers, C.
Citation: Kolk, M.; van der Graaf, M.; Fransen, C.; Wijmenga, S.; Pleij, C.; Heus, H.; Hilbers, C.. "Structure of the 3' hairpin of the TYMV pseudoknot: Preformation in RNA folding" EMBO J. 17, 7498-7504 (1998).
Assembly members:
3' hairpin of TYMV pseudoknot, polymer, 23 residues, Formula weight is not available
Natural source: Common Name: TYMV Taxonomy ID: 12154 Superkingdom: viruses Kingdom: not available Genus/species: Tymovirus Turnip yellow mosaic virus
Experimental source: Production method: enzymatic semisynthesis
Entity Sequences (FASTA):
3' hairpin of TYMV pseudoknot: GGUUCCGAGGGUCAUCGGAA
CCA
- assigned_chemical_shifts
| Data type | Count |
| 1H chemical shifts | 149 |