BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 4250

Title: Structure of the 3' hairpin of the TYMV pseudoknot: Preformation in RNA folding

Deposition date: 1998-10-15 Original release date: 2000-02-25

Authors: Kolk, M.; van der Graaf, M.; Fransen, C.; Wijmenga, S.; Pleij, C.; Heus, H.; Hilbers, C.

Citation: Kolk, M.; van der Graaf, M.; Fransen, C.; Wijmenga, S.; Pleij, C.; Heus, H.; Hilbers, C.. "Structure of the 3' hairpin of the TYMV pseudoknot: Preformation in RNA folding"  EMBO J. 17, 7498-7504 (1998).

Assembly members:
3' hairpin of TYMV pseudoknot, polymer, 23 residues, Formula weight is not available

Natural source:   Common Name: TYMV   Taxonomy ID: 12154   Superkingdom: viruses   Kingdom: not available   Genus/species: Tymovirus Turnip yellow mosaic virus

Experimental source:   Production method: enzymatic semisynthesis

Entity Sequences (FASTA):
3' hairpin of TYMV pseudoknot: GGUUCCGAGGGUCAUCGGAA CCA

Data sets:
Data typeCount
1H chemical shifts149

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1TYMV-RNA1

Entities:

Entity 1, TYMV-RNA 23 residues - Formula weight is not available

1   GGUUCCGAGG
2   GUCAUCGGAA
3   CCA

Samples:

sample_one: 3' hairpin of TYMV pseudoknot 3.5 mM

sample_conditions_one: pH*: 6.8; temperature: 295 K

Experiments:

NameSampleSample stateSample conditions
NOESYsample_onenot availablesample_conditions_one
DQF COSYsample_onenot availablesample_conditions_one
{31P-1H} HETCORsample_onenot availablesample_conditions_one
{13C-1H} HMQCsample_onenot availablesample_conditions_one

Software:

No software information available

NMR spectrometers:

  • Bruker AM 400 MHz
  • Bruker AMX 600 MHz