BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 4400

Title: Structure and Mechanism of Formation of the H-y5 ismomer of an Intramolecular DNA Triple Helix.

Deposition date: 1999-09-11 Original release date: 1999-10-26

Authors: van Dongen, M.; Doreleijers, J.; van der Marel, G.; van Boom, J.; Hilbers, C.; Wijmenga, S.

Citation: van Dongen, M.; Doreleijers, J.; van der Marel, G.; van Boom, J.; Hilbers, C.; Wijmenga, S.. "Structure and Mechanism of Formation of the H-y5 isomer of an intramolecular DNA triple helix"  Nat. Struct. Biol. 6, 854-859 (1999).

Assembly members:
H-y5 Triple Helix, polymer, 30 residues, Formula weight is not available

Natural source:   Common Name: not available   Taxonomy ID: not available   Superkingdom: not available   Kingdom: not available   Genus/species: not available not available

Experimental source:   Production method: chemically_synthesized

Entity Sequences (FASTA):
H-y5 Triple Helix: TCTTCCTTTTCCTTCTCCCG AGAAGGTTTT

Data sets:
Data typeCount
1H chemical shifts247

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all