BMRB Entry 4816
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR4816
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: Structural Features of an Influenza Virus Promoter and their Implications for Viral RNA Synthesis PubMed: 11553808
Deposition date: 2000-08-23 Original release date: 2002-04-04
Authors: Bae, S.-H.; Cheong, H.-K.; Lee, J.-H.; Cheong, C.; Kainosho, M.; Choi, B.-S.
Citation: Bae, S.-H.; Cheong, H.-K.; Lee, J.-H.; Cheong, C.; Kainosho, M.; Choi, B.-S.. "Structural Features of an Influenza Virus Promoter and Their Implications for Viral RNA Synthesis" Proc. Natl. Acad. Sci. U.S.A. 98, 10602-10607 (2001).
Assembly members:
INFLUENZA A VIRUS PROMOTER RNA, polymer, 31 residues, Formula weight is not available
Natural source: Common Name: not available Taxonomy ID: 11320 Superkingdom: viruses Kingdom: not available Genus/species: Influenza virus type A Influenza A virus
Experimental source: Production method: enzymatic semisynthesis
Entity Sequences (FASTA):
INFLUENZA A VIRUS PROMOTER RNA: AGUAGAAACAAGGCUUCGGC
CUGCUUUUGCU
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 39 |
| 15N chemical shifts | 23 |
| 31P chemical shifts | 22 |