BMRB Entry 5167
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR5167
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: NMR Structure of an AT-Rich DNA with the GAA-Hairpin Loop PubMed: 11991355
Deposition date: 2001-10-03 Original release date: 2002-09-26
Authors: Ulyanov, N.; Bauer, W.; James, T.
Citation: Ulyanov, N.; Bauer, W.; James, T.. "High-resolution NMR Structure of an AT-rich DNA Sequence" J. Biomol. NMR 22, 265-280 (2002).
Assembly members:
GAA-Hairpin loop, polymer, 27 residues, Formula weight is not available
Natural source: Common Name: not available Taxonomy ID: not available Superkingdom: not available Kingdom: not available Genus/species: not available not available
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
GAA-Hairpin loop: CCTAATTATAACGAAGTTAT
AATTAGG
- assigned_chemical_shifts
| Data type | Count |
| 1H chemical shifts | 252 |